FAM200C

Family with Member 200 C (FAM200C) is a protein, which in humans is encoded by the FAM200C gene. The primary aliases of the gene are ZBED8, C5orf54, and Buster3.[1]

Gene

In the human genome, FAM200C is located on the minus strand of chromosome 5, at 5q33.3. FAM200C can be transcribed into 2 different transcript variants, which contain 3 and 2 exons, respectively.[1]

Location of FAM200C on Human Chromosome 5, specifically 5q33.3

Expression

FAM200C is expressed ubiquitously and variably in human tissues, with a 10-fold difference between the lowest and highest expression values (~0.23-2.3).[1] FAM200C has the highest tissue expression in the ovaries, followed by the endometrium, thyroid, testis, and prostate.[2]

mRNA

FAM200C mRNA has 2 transcript variants. FAM200C Variant 1 is the longest in terms of nucleotide length, spanning 2,882 nucleotides.[1]

FAM200C Transcript Variants
Transcript Variant Variant Length (nt) Accession Number Protein Protein Length (aa)
FAM200C Variant 1 2,882 NM_001303251.2 NP_001290180.1 594
FAM200C Variant 2 2,808 NM_022090.5 NP_071373.2 594

Protein

The Family with Sequence Similarity 200 Member C protein in Homo sapiens is encoded by the FAM200C gene. Protein FAM200C has a predicted molecular weight of 68326.71 Da, with a theoretical isoelectric point of 5.98.[3] The protein is localized to the Nucleoplasm.[4]

Promoter

Using UCSC's Genome Browser, a promoter region sequence was found. The most likely promoter region for FAM200C starts at 160,399,954 and goes to 160,400,554, with a length of 601 base pairs.[5]

Protein interactions

FAM200C Predicted Functional Partners from STRING[6]
Protein Full Name Description Score
METTL21A Methyltransferase 21A, HSPA Lysine Enables ATPase binding activity, Hsp70 protein binding activity, and protein-lysine N-methyltransferase activity[7] 0.732
PGBD2 PiggyBac transposable element derived 2 Protein-coding gene, that interacts directly with DNA.[8] 0.692
THAP9 THAP domain containing 9 Enables sequence-specific DNA binding activity and transposase activity.[9] 0.586
GIN1 Gypsy retrotransposon integrase 1 Predicted to enable nucleic acid binding activity.[10] 0.541
CRLF3 Cytokine receptor like factor 3 Encodes a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase.[11] 0.505
ZNF862 Zinc finger protein 862 Predicted to enable protein dimerization activity and zinc ion binding activity.[12] 0.501
POGK Pogo transposable element derived with KRAB domain Contains a KRAB domain at the N-terminus and a transposase domain at the C-terminus.[13] 0.499
PGBD1 PiggyBac transposable element derived 1 Belongs to the subfamily of piggyBac transposable element derived genes; expressed in the brain.[14] 0.489
PGBD5 PiggyBac transposable element derived 5 Belongs to the subfamily of piggyBac transposable element derived genes.[15] 0.477
NAIF1 Nuclear apoptosis inducing factor 1 Predicted to be involved in negative regulation of cell growth and regulation of mitochondrial membrane permeability involved in apoptotic process.[16] 0.460

Structure

Secondary structure

The figure "FAM200C Predicted Secondary Structure" 1 and 2 provide a Phyre2.2 model prediction of FAM200C's secondary structure. Model indicates secondary structure is predicted to be composed of 9% disordered, 45% alpha helices, and 8% beta strands.[17]

FAM200C Predicted Secondary Structure: Phyre2.2: A Community Resource for Template-based Protein Structure Prediction Powell HR et al. Journal of Molecular Biology (2025) in press DOI: https://doi.org/10.1016/j.jmb.2025.168960
FAM200C Predicted Secondary Structure 1
FAM200C Predicted Secondary Structure: Phyre2.2: A Community Resource for Template-based Protein Structure Prediction Powell HR et al. Journal of Molecular Biology (2025) in press DOI: https://doi.org/10.1016/j.jmb.2025.168960
FAM200C Predicted Secondary Structure 2

Tertiary structure

FAM200C tertiary structure predictions available through Phyre2.2 and AlphaFold.

Predicted Tertiary Structure of FAM200C made through Phyre2.2
Predicted FAM200C Tertiary Structure made through AlphaFold

Gene ontology

The figure titled "FAM200C Mature miRNA Sequences by Target Score" shows the 8 mature miRNA sequences for FAM200C available through text mining.[18]

FAM200C Mature miRNA Sequences by Target Score
miRNA Name Target Score Seed Location miRNA Sequence
hsa-miR-767-5p 76 291 UGCACCAUGGUUGUCUGAGCAUG
hsa-miR-627-3p 73 171, 321 UCUUUUCUUUGAGACUCACU
hsa-miR-550a-3p 70 454 UGUCUUACUCCCUCAGGCACAU
hsa-miR-4524a-3p 65 64 UGAGACAGGCUUAUGCUGCUAU
hsa-miR-942-5p 62 326 UCUUCUCUGUUUUGGCCAUGUG
hsa-miR-449c-5p 60 188 UAGGCAGUGUAUUGCUAGCGGCUGU
hsa-miR-34b-5p 60 188 UAGGCAGUGUCAUUAGCUGAUUG
hsa-miR-376c-3p 60 95 AACAUAGAGGAAAUUCCACGU

Evolutionary history

FAM200C first arose around 94 million years ago. FAM200C is part of the Ribonuclease H-like superfamily.[1] A Swedish University for Agricultural Sciences research team led by Dr.Alexander Hayward and Dr.Awaisa Ghazal, studying the evolutionary origins of the ZBED genes published a paper in PLOS one, reporting that: "ZBED proteins, such as C5ORF54, or ZBED8, originated from domesticated hAT DNA transposons and encode regulatory proteins with diverse, fundamental functions in vertebrates."[19]

Orthologs

FAM200C orthologs were found exclusively in mammals. The most distantly related ortholog, Talpa occidentalis, has two transcript variants.[1]

Orthologs of FAM200C protein in order of increasing divergence from Homo sapiens
Taxonomic Class Taxonomic Order Genus and Species Common Name Date of Divergence (MYA) Accession Number Sequence Length (aa) Sequence Identity (%) Sequence Similarity (%)
Mammalia Primates Homo sapiens Human 0 NP_001290180.1 594 100 100
Mammalia Primates Gorilla gorilla gorilla Gorilla 8.6 XP_004042980.2 594 99 100
Mammalia Primates Macaca nemestrina Pig-tailed macaque 28.8 XP_001084430.1 593 98 99
Mammalia Primates Trachypithecus francoisi Francois' langur 28.8 XP_033036286.1 593 98 99
Mammalia Primates Cebus imitator Panamanian white-faced capuchin 43 XP_017357604.1 594 97 100
Mammalia Primates Saimiri boliviensis Bolivian squirrel monkey 43 XP_074246649.1 633 97 100
Mammalia Primates Otolemur garnettii Small-eared gelago 74 XP_012664265.1 594 94 100
Mammalia Artiodactyla Camelus dromedarius Arabian camel 94 XP_010991120.3 594 94 100
Mammalia Perissodactyla Equus quagga Plains zebra 94 XP_046524538.1 641 94 100
Mammalia Carnivora Leopardus geoffroyi Geoffroy's cat 94 XP_045358866.1 594 94 100
Mammalia Carnivora Mirounga leonina Southern elephant seal 94 XP_034869533.1 594 94 100
Mammalia Carnivora Zalophus californianus California sea lion 94 XP_027462964.1 639 94 100
Mammalia Carnivora Vulpes lagopus Arctic fox 94 XP_041602806.1 593 94 100
Mammalia Carnivora Neogale vison American mink 94 XP_044086173.1 594 93 100
Mammalia Carnivora Mustela lutreola European mink 94 XP_059030193.1 549 93 100
Mammalia Chiroptera Pteronotus mesoamericanus Pteronotus parnellii mesoamericanus 94 XP_054423860.1 594 93 100
Mammalia Chiroptera Molossus molossus Pallas' mastiff bat 94 XP_036098001.1 594 92 100
Mammalia Eulipotypha Talpa occidentalis Iberian mole 94 XP_036098001.1 594 92 100

Paralogs

FAM200C has 18 paralogs. Based on target % identity to FAM200C (>20%), the three most significant paralogs are FAM200A, FAM200B, and ZBED5.

FAM200C Paralogs with >20% Target Identity
Name Full Name Target % Identity Sequence Length (aa) Accession Number Location
FAM200A Family with Sequence Similarity 200 Member A 29.49 573 ENSG00000221909 7:99,546,300-99,559,392:-1
FAM200B Family with Sequence Similarity 200 Member B 29.70 657 ENSG00000237765 4:15,681,506-15,690,447:1
ZBED5 Zinc Finger BED-type Containing 5 27.13 693 ENSG00000236287 11:10,812,074-10,858,796:-1

Multiple sequence alignment

The figure titled "Snippet of FAM200C Orthologs Multiple Sequence Alignment" shows a snippet of the multiple sequence alignment for FAM200C orthologs.[20] This snippet represents the conservation of FAM200C as most of the sequence is conserved.

Multiple Sequence Alignment made using Clustal Omega software
Snippet of FAM200C Orthologs Multiple Sequence Alignment

Protein divergence

As shown in the figure titled "Informational context of FAM200C human protein...", the human FAM200C protein, is evolving slowly over time in comparison to both Fibrinogen Alpha and Cytochrome C.[1]

Informational Context of FAM200C Human Protein in Comparison to Cytochrome C and Fibrinogen Alpha Through Alignment of 8 Orthologs

Conceptual translation

The figure titled "Conceptual Translation for FAM200C" shows the conceptual translation (full mRNA and amino acid sequence) of the human FAM200C transcript variant 1 showing exon boundaries, domains/motifs, polyadenylation sites, and phosphorylation sites, and a legend.

Conceptual translation of FAM200C 1
Conceptual translation of FAM200C 2
Conceptual translation of FAM200C 3

Single nucleotide polymorphisms

There are 3734 single nucleotide polymorphisms catalogued in NCBI's Variation Viewer, only one of which has a clinical significance record.[21] The only clinically significant single nucleotide polymorphism found, rs61740683, is a synonymous, single nucleotide variant with benign clinical significance.[22]

Clinical significance

FAM200C promoter could have a dual function as it starts transcription for the FAM200C gene and also an enhancer for the gene miR-146a. In a 2023 study published to the Arthritis and Rheumatology Journal for the American College of Rheumatology, researchers Xinyi Zhu, et al. discovered that when the FAM200C gene was knocked down, the expression levels for miR-146a were unaffected. This suggests that the promoter regions could also function as enhancers and regulate the expression of genes in close proximity.[23] FAM200C is also a potential biomarker for Sarcoidosis. In a 2020 study published to the Medical Science Monitor, Min Zhao et al. identified FAM200C as a "SARC-only DEG". The researchers found that FAM200C is up-regulated in Sarcoidosis, meaning there is increased gene expression in patients with Sarcoidosis compared to patients with Pulmonary Tuberculosis and healthy control patients.[24]

Text-Based Information

References

  1. ^ a b c d e f g "FAM200C family with sequence similarity 200 member C [Homo sapiens (human)]". National Library of Medicine: National Center for Biotechnology Information. 25 November 2025. Retrieved 20 September 2025.
  2. ^ Fagerberg, Linn; Hallström, Björn M.; Oksvold, Per; Kampf, Caroline; Djureinovic, Dijana; Odeberg, Jacob; Habuka, Masato; Tahmasebpoor, Simin; Danielsson, Angelika; Edlund, Karolina; Asplund, Anna; Sjöstedt, Evelina; Lundberg, Emma; Szigyarto, Cristina Al-Khalili; Skogs, Marie (February 2014). "Analysis of the Human Tissue-specific Expression by Genome-wide Integration of Transcriptomics and Antibody-based Proteomics". Molecular & Cellular Proteomics. 13 (2): 397–406. doi:10.1074/mcp.M113.035600. PMC 3916642. PMID 24309898.
  3. ^ "Expasy - Compute pI/MW". web.expasy.org. Retrieved 2025-12-03.
  4. ^ Thul, Peter J.; Åkesson, Lovisa; Wiking, Mikaela; Mahdessian, Diana; Geladaki, Aikaterini; Ait Blal, Hammou; Alm, Tove; Asplund, Anna; Björk, Lars; Breckels, Lisa M.; Bäckström, Anna; Danielsson, Frida; Fagerberg, Linn; Fall, Jenny; Gatto, Laurent (2017-05-26). "A subcellular map of the human proteome". Science. 356 (6340) eaal3321. Bibcode:2017Sci...356l3321T. doi:10.1126/science.aal3321. ISSN 0036-8075. PMID 28495876.
  5. ^ genome.ucsc.edu https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr5:160399954-160400554&hgsid=3349128123_ebSId1dWVrvdz5GQspGg8omHvaFL. Retrieved 2025-12-03. {{cite web}}: Missing or empty |title= (help)
  6. ^ "ZBED8 protein (human) - STRING interaction network". string-db.org. Retrieved 2025-12-01.
  7. ^ METTL21A protein summary data for this paper were retrieved from the Alliance of Genome Resources, URL: https://www.alliancegenome.org; December 1, 2025; Version: 8.2.0
  8. ^ PGBD2 [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2025/12/01]. Available from: https://www.ncbi.nlm.nih.gov/gene/
  9. ^ THAP9 protein summary data for this paper were retrieved from the Alliance of Genome Resources, URL: https://www.alliancegenome.org; December 1, 2025; Version: 8.2.0
  10. ^ GIN1 protein summary data for this paper were retrieved from the Alliance of Genome Resources, URL: https://www.alliancegenome.org; December 1, 2025; Version: 8.2.0
  11. ^ CRLF3 [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2025/12/01]. Available from: https://www.ncbi.nlm.nih.gov/gene/
  12. ^ ZNF862 protein summary data for this paper were retrieved from the Alliance of Genome Resources, URL: https://www.alliancegenome.org; December 1, 2025; Version: 8.2.0
  13. ^ POGK [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2025/12/01]. Available from: https://www.ncbi.nlm.nih.gov/gene/
  14. ^ PGBD1 [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2025/12/01]. Available from: https://www.ncbi.nlm.nih.gov/gene/
  15. ^ PGBD5 [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2025/12/01]. Available from: https://www.ncbi.nlm.nih.gov/gene/
  16. ^ NAIF1 protein summary data for this paper were retrieved from the Alliance of Genome Resources, URL: https://www.alliancegenome.org; December 1, 2025; Version: 8.2.0
  17. ^ Phyre2.2: A Community Resource for Template-based Protein Structure Prediction Powell HR et al. Journal of Molecular Biology (2025) in press DOI: https://doi.org/10.1016/j.jmb.2025.168960
  18. ^ Yuhao Chen and Xiaowei Wang (2020) miRDB: an online database for prediction of functional microRNA targets. Nucleic Acids Research. 48(D1):D127-D131.
  19. ^ Hayward, Alexander; Ghazal, Awaisa; Andersson, Göran; Andersson, Leif; Jern, Patric (2013-03-22). Robinson-Rechavi, Marc (ed.). "ZBED Evolution: Repeated Utilization of DNA Transposons as Regulators of Diverse Host Functions". PLOS ONE. 8 (3) e59940. Bibcode:2013PLoSO...859940H. doi:10.1371/journal.pone.0059940. ISSN 1932-6203. PMC 3606216. PMID 23533661.
  20. ^ Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. (2024). The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Research, April 10, 2024; doi: 10.1093/nar/gkae241; Europe PMC: 38597606
  21. ^ "Variation Viewer". www.ncbi.nlm.nih.gov. Retrieved 2025-12-13.
  22. ^ "Supplemental Information 3: Perl script to parse ClinVar entries". doi:10.7717/peerj.8106/supp-3.
  23. ^ Zhu, X., Zhang, Y., Yin, Z., Ye, Z., Qin, Y., Cheng, Z., Shen, Y., Yin, Z., Ma, J., Tang, Y., Ding, H., Guo, Y., Hou, G. and Shen, N. (2024), Three-Dimensional Chromosomal Landscape Revealing miR-146a Dysfunctional Enhancer in Lupus and Establishing a CRISPR-Mediated Approach to Inhibit the Interferon Pathway. Arthritis Rheumatol, 76: 384-395. https://doi.org/10.1002/art.42703
  24. ^ Zhao M, Di X, Jin X, Tian C, Cong S, Liu J, Wang K. Identification of Biomarkers for Sarcoidosis and Tuberculosis of the Lung Using Systematic and Integrated Analysis. Med Sci Monit. 2020 Jul 23;26:e925438. doi: 10.12659/MSM.925438. PMID 32701935; PMCID: PMC7397754.